Top » Catalog » SNPs » S775

$18.00

S775
[S775]

S775
HG19 Position: ChrY:14781283..14781283
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream DF41. Steward branch
Forward Primer: S775_F TTAAACCCCTGACCTTGTGG
Reverse Primer: S775_R AGGGACTTTGCCCTCTAAGC
Reviews

Customers who bought this product also purchased
FGC11134
FGC11134
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
DF49
DF49
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies