Top » Catalog » SNPs » S775

$17.50

S775
[S775]

S775
HG19 Position: ChrY:14781283..14781283
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Downstream DF41. Steward branch
Forward Primer: S775_F TTAAACCCCTGACCTTGTGG
Reverse Primer: S775_R AGGGACTTTGCCCTCTAAGC
Reviews

Customers who bought this product also purchased
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
FGC11134
FGC11134
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies