Top » Catalog » SNPs » S775

$18.00

S775
[S775]

S775
hg38 Position: ChrY:12669353..12669353
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a2c1i1
Comments: Downstream DF41. Steward branch
Forward Primer: S775_F TTAAACCCCTGACCTTGTGG
Reverse Primer: S775_R AGGGACTTTGCCCTCTAAGC
Reviews

Customers who bought this product also purchased
A98
A98
FGC13023
FGC13023
L1335
L1335
BY23955
BY23955
Z39589
Z39589
BY23827
BY23827
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies