Top » Catalog » SNPs » FGC22956

$18.00

FGC22956
[FGC22956]

FGC22956
hg38 Position: ChrY:14477570..14477570
Ancestral: G
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1c1c1
Comments: .
Forward Primer: FGC22956_F TGCAGTGAGCCATGATGC
Reverse Primer: FGC22956_R ATCATGGGGACTTCCCTAGC
Reviews

Customers who bought this product also purchased
DYS481
DYS481
DYS520
DYS520
FGC22952
FGC22952
FGC22963
FGC22963
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies