Top » Catalog » SNPs » S9355

$18.00

S9355
[S9355]

S9355
hg38 Position: ChrY:6836164..6836164
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1
Comments: .
Forward Primer: S9355_F TGAAAGAAAGGGGTGTGAGG
Reverse Primer: S9355_R ATATTCAAGCCCAAGCATCC
Reviews

Customers who bought this product also purchased
Y5058
Y5058
L21
L21
FGC23074
FGC23074
Z2571
Z2571
L617
L617
Z2573
Z2573
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A1455
$18.00
Haplogroup Info
Other products
Currencies