Top » Catalog » SNPs » DF98

$18.00

DF98
[DF98]

DF98
hg38 Position: ChrY:16953762..16953762
Ancestral: A
Derived: C
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Parallel branch to DF96 below Z306
Forward Primer: DF98_F ACTAGGCATTCATGGAACATAAC
Reverse Primer: DF98_R TAACAGAAGGCTCACCCTGTTA
Reviews

Customers who bought this product also purchased
YSEQ-Alpha
YSEQ-Alpha
P89.2
P89.2
FGC13316
FGC13316
S16265
S16265
HVR1
HVR1
FT363853
FT363853
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies