Top » Catalog » SNPs » DF98

$18.00

DF98
[DF98]

DF98
hg38 Position: ChrY:16953762..16953762
Ancestral: A
Derived: C
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Parallel branch to DF96 below Z306
Forward Primer: DF98_F ACTAGGCATTCATGGAACATAAC
Reverse Primer: DF98_R TAACAGAAGGCTCACCCTGTTA
Reviews

Customers who bought this product also purchased
A993
A993
BY12505
BY12505
FGC23212
FGC23212
A14207
A14207
BY128969
BY128969
JFS0006
JFS0006
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies