Top » Catalog » SNPs » DF98

$18.00

DF98
[DF98]

DF98
hg38 Position: ChrY:16953762..16953762
Ancestral: A
Derived: C
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Parallel branch to DF96 below Z306
Forward Primer: DF98_F ACTAGGCATTCATGGAACATAAC
Reverse Primer: DF98_R TAACAGAAGGCTCACCCTGTTA
Reviews

Customers who bought this product also purchased
FGC39806
FGC39806
FGC34175
FGC34175
S11477
S11477
S1798
S1798
FGC50047
FGC50047
A7212
A7212
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A2184
1 x A1332
1 x A2248
1 x A1338
1 x A2195
1 x A880
1 x A468
$126.00
Haplogroup Info
Other products
Currencies