Top » Catalog » SNPs » DF98

$18.00

DF98
[DF98]

DF98
hg38 Position: ChrY:16953762..16953762
Ancestral: A
Derived: C
Reference: Andy Gierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1c1a1
Comments: Parallel branch to DF96 below Z306
Forward Primer: DF98_F ACTAGGCATTCATGGAACATAAC
Reverse Primer: DF98_R TAACAGAAGGCTCACCCTGTTA
Reviews

Customers who bought this product also purchased
FT363853
FT363853
FGC39800
FGC39800
BY20379
BY20379
BY118350
BY118350
FGC60496
FGC60496
FTA16931
FTA16931
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies