Top » Catalog » SNPs » ZS5806

$18.00

ZS5806
[ZS5806]

ZS5806
hg38 Position: ChrY:14805349..14805349
Ancestral: A
Derived: T
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream FGC1713. Found in Big Y sample 356224. Aka FGC23916
Forward Primer: ZS5806_F CAATGGTTGTTCTGACGTGTG
Reverse Primer: ZS5806_R GCAGCGTACAATTGTGGAAC
Reviews

Customers who bought this product also purchased
A16980
A16980
FTA35962
FTA35962
A27224
A27224
ZS11672
ZS11672
FGC34530
FGC34530
FT135012
FT135012
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies