Top » Catalog » SNPs » FGC22538

$18.00

FGC22538
[FGC22538]

FGC22538
hg38 Position: ChrY:15987358..15987358
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1
Comments: Above FGC22516 and below FGC22501
Forward Primer: FGC22538_F TGAGCCACCACACCCATC
Reverse Primer: FGC22538_R GTTCAAATGGACATCTGCCAC
Reviews

Customers who bought this product also purchased
FGC4166
FGC4166
FGC36261
FGC36261
L21
L21
FGC36273
FGC36273
P312
P312
A12406
A12406
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies