Top » Catalog » SNPs » FGC22538

$18.00

FGC22538
[FGC22538]

FGC22538
hg38 Position: ChrY:15987358..15987358
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1
Comments: Above FGC22516 and below FGC22501
Forward Primer: FGC22538_F TGAGCCACCACACCCATC
Reverse Primer: FGC22538_R GTTCAAATGGACATCTGCCAC
Reviews

Customers who bought this product also purchased
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
FGC8158
FGC8158
S16930
S16930
FGC4166
FGC4166
FGC36261
FGC36261
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies