Top » Catalog » SNPs » FGC22538

$18.00

FGC22538
[FGC22538]

FGC22538
hg38 Position: ChrY:15987358..15987358
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1
Comments: Above FGC22516 and below FGC22501
Forward Primer: FGC22538_F TGAGCCACCACACCCATC
Reverse Primer: FGC22538_R GTTCAAATGGACATCTGCCAC
Reviews

Customers who bought this product also purchased
S1569
S1569
BY3508
BY3508
Z192
Z192
Z367
Z367
A6454
A6454
L199
L199
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies