Top » Catalog » SNPs » FGC22538

$18.00

FGC22538
[FGC22538]

FGC22538
hg38 Position: ChrY:15987358..15987358
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a1a2a1a2b1d1
Comments: Above FGC22516 and below FGC22501
Forward Primer: FGC22538_F TGAGCCACCACACCCATC
Reverse Primer: FGC22538_R GTTCAAATGGACATCTGCCAC
Reviews

Customers who bought this product also purchased
BY25318
BY25318
FT410015
FT410015
A1718
A1718
BY25320
BY25320
Y3964
Y3964
BY169025
BY169025
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies