Top » Catalog » SNPs » CTS3104

$18.00

CTS3104
[CTS3104]

CTS3104
hg38 Position: ChrY:12554482..12554482
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3104_F CCATGCCCCTCTTAACTCTG
Reverse Primer: CTS3104_R GGGCTGTGGACCATAGTTTG
Reviews

Customers who bought this product also purchased
Y18625
Y18625
U106
U106
S5940
S5940
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
L200
L200
S268
S268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies