Top » Catalog » SNPs » CTS3104

$18.00

CTS3104
[CTS3104]

CTS3104
hg38 Position: ChrY:12554482..12554482
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS3104_F CCATGCCCCTCTTAACTCTG
Reverse Primer: CTS3104_R GGGCTGTGGACCATAGTTTG
Reviews

Customers who bought this product also purchased
Z326
Z326
Y83097
Y83097
S511
S511
Y18625
Y18625
U106
U106
S5940
S5940
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies