Top » Catalog » SNPs » DF95

$18.00

DF95
[DF95]

DF95
hg38 Position: ChrY:16816018..16816018
Ancestral: G
Derived: C
Reference: Grierson (2013)
ISOGG Haplogroup: R1b1a1a2a1a1b1b
Comments: Downstream of Z18; parallel to Z372
Forward Primer: DF95_F TCCTTGAGGAGGGTAGGATATGT
Reverse Primer: DF95_R GACAACAGGAAGGAGCCCATA
Reviews

Customers who bought this product also purchased
Z372
Z372
S7047
S7047
Z381
Z381
FGC5797
FGC5797
S8402
S8402
S11601
S11601
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies