Top » Catalog » SNPs » A27137

$18.00

A27137
[A27137]

A27137
hg38 Position: ChrY:14103315..14103315
Ancestral: C
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC1713 > Y16746
Forward Primer: A27137_F CTGTACATCACCATGGTCAAAGG
Reverse Primer: A27137_R CGAGGAGTGTCTTTGTGGCA
Reviews

Customers who bought this product also purchased
ZS5806
ZS5806
A16980
A16980
FTA35962
FTA35962
Y16746
Y16746
A27224
A27224
ZS11672
ZS11672
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies