Top » Catalog » SNPs » A27969

$18.00

A27969
[A27969]

A27969
hg38 Position: ChrY:17193294..17193294
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27969_F AGACCTTGAGTCTCTCTTTGGC
Reverse Primer: A27969_R CTCTGAGCATTCGGTGCTG
Reviews

Customers who bought this product also purchased
A27970
A27970
A27968
A27968
A27967
A27967
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies