Top » Catalog » SNPs » A27970

$18.00

A27970
[A27970]

A27970
hg38 Position: ChrY:26339906..26339906
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27970_F GTCTGCTTTCAAGGGAATGC
Reverse Primer: A27970_R TGCTGTGCTAGCAATCAGCA
Reviews

Customers who bought this product also purchased
A27968
A27968
A27967
A27967
A27969
A27969
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies