Top » Catalog » SNPs » A27952

$18.00

A27952
[A27952]

A27952
hg38 Position: ChrY:19176711..19176711
Ancestral: C
Derived: T
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27952_F AATTAGGTATTGATGGGACGTGTC
Reverse Primer: A27952_R AATCTATCAATTACCTTGGGCGT
Reviews

Customers who bought this product also purchased
A27137
A27137
A27141
A27141
A27953
A27953
A27951
A27951
A27950
A27950
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies