Top » Catalog » SNPs » PH1501

$18.00

PH1501
[PH1501]

PH1501
hg38 Position: ChrY:12780474..12780474
Ancestral: C
Derived: T
Reference: Pille Hallast et al. (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: PH1501_F GCGTTACCGCATCCTTACTC
Reverse Primer: PH1501_R CCATTCCAAGGCACTTCATC
Reviews

Customers who bought this product also purchased
FT249919
FT249919
FGC3733
FGC3733
J1-FGC3723 Panel
J1-FGC3723 Panel
FT249260
FT249260
BY73065
BY73065
Z18257
Z18257
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies