Top » Catalog » SNPs » L46

$18.00

L46
[L46]

L46
hg38 Position: ChrY:16965529..16965529
Ancestral: A
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a1c2b1a1a
Comments: .
Forward Primer: L46_F AATTGGTGGGAACCCTAAGC
Reverse Primer: L46_R ACTTGACCCAGGACCTGTTG
Reviews

Customers who bought this product also purchased
Z159
Z159
BZ2
BZ2
FGC6198
FGC6198
L163
L163
BY13042
BY13042
FGC6218
FGC6218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies