Top » Catalog » SNPs » L493

$18.00

L493
[L493]

L493
hg38 Position: ChrY:13688446..13688446
Ancestral: T
Derived: G
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a2a1a1c2b1a1a1a
Comments: derived under R-L45
Forward Primer: L493_F TTCCAGGTGCAACACTTCTG
Reverse Primer: L493_R AGGTGATTGGAGGGTCTTTG
Reviews

Customers who bought this product also purchased
Z159
Z159
FGC29470
FGC29470
FGC8604
FGC8604
FGC6204
FGC6204
A6714
A6714
FGC6225
FGC6225
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies