Top » Catalog » SNPs » DF29

$18.00

DF29
[DF29]

DF29
hg38 Position: ChrY:3758238..3758238
Ancestral: A
Derived: G
Reference: Greg Magoon (2011)
ISOGG Haplogroup: I1a
Comments: Expected to encompass (L2. Z58. Z63) x Z131
Forward Primer: DF29_F TTGTGATGGGAAAGGGGAGCCAC
Reverse Primer: DF29_R AAAAGGCAGAAACTGTGTTTAACTGCAGT
Reviews

Customers who bought this product also purchased
S10066
S10066
FGC15560
FGC15560
Y11205
Y11205
S10908
S10908
A14157
A14157
Y16456
Y16456
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies