Honichtopf
Cart Contents
Checkout
My Account
Top
»
Catalog
»
SNPs
»
B405
$19.00
B405
[B405]
hg38 Position:
ChrY:6906292..6906292
Ancestral:
A
Derived:
C
Reference:
Karmin et al. (2015)
ISOGG Haplogroup:
E1b1b1b2a1a4d2b~
Comments:
Below Y6938
Forward Primer:
B405_F TCTCTTTGCCTACTGCCATTC
Reverse Primer:
B405_R CTGCAGAGGGCTGTGATAAAC
Add to Cart
Reviews (1)
Customers who bought this product also purchased
Y22843
A10728
Y22842
Y6940
Y134217
Y4970
Categories
Y Haplogroup Panels
(96)
Y Custom SNP Panels
(214)
SNPs
(413751)
Y-STR Beginner Panels
(3)
Y-STR Enhanced Panels->
(6)
Y-STRs
(126)
mtDNA Beginner Tests
(3)
mtDNA Enhanced Tests->
(31)
NGS Tests->
(5)
Various
(5)
Haplogroups
Please Select
A0
A00
A1a
A1b
A1b1
B
C
D
E
G
H
I1
I2
J1
J2
L
LT
M
N
O
other
Q
R1a
R1b
R2
S
T
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
Reviews
An FTDNA project had a B405 results for all of its members d ..
Information
Shipping & Returns
Privacy Notice
Conditions of Use
F.A.Q.
Contact Us
Impressum
Currencies
U.S. Dollar
Euro