Top » Catalog » SNPs » B405

$18.00

B405
[B405]

B405
hg38 Position: ChrY:6906292..6906292
Ancestral: A
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E1b1b1b2a1a4d2b~
Comments: Below Y6938
Forward Primer: B405_F TCTCTTTGCCTACTGCCATTC
Reverse Primer: B405_R CTGCAGAGGGCTGTGATAAAC
Reviews

Customers who bought this product also purchased
Y15936
Y15936
YCAII
YCAII
M35
M35
Y15561
Y15561
CDY
CDY
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies