Top » Catalog » Y SNPs » B405

$18.00

B405
[B405]

B405
hg38 Position: ChrY:6906292..6906292
Ancestral: A
Derived: C
Reference: Karmin et al. (2015)
ISOGG Haplogroup: E1b1b1b2a1a4d2b~
Comments: Below Y6938
Forward Primer: B405_F TCTCTTTGCCTACTGCCATTC
Reverse Primer: B405_R CTGCAGAGGGCTGTGATAAAC
Reviews (1)

Customers who bought this product also purchased
Y179930
Y179930
Y22843
Y22843
A10728
A10728
Y22842
Y22842
Y6940
Y6940
Y134217
Y134217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies