Top » Catalog » SNPs » FT131537

$18.00

FT131537
[FT131537]

FT131537
hg38 Position: ChrY:16645511..16645511
Ancestral: T
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT131537_F GGGATTACAGGCATGAGCTG
Reverse Primer: FT131537_R CAATTCAGAACCTGAAATAAATATCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies