Top » Catalog » SNPs » Z11

$18.00

Z11
[Z11]

Z11
hg38 Position: ChrY:14079000..14079000
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a1
Comments: beneath L48. parallel to L47;downstream of Z3. Z4. Z5. Z8. parallel to Z1
Forward Primer: Z11_F TGAAATTAGTACAAGGAAATCGGG
Reverse Primer: Z11_R CATTTTAGACCAGACTCTTAGGACCTC
Reviews

Customers who bought this product also purchased
FGC5254
FGC5254
BY20804
BY20804
BY13828
BY13828
BY119
BY119
Y15633
Y15633
Y15883
Y15883
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies