Top » Catalog » SNPs » Z18

$18.00

Z18
[Z18]

Z18
hg38 Position: ChrY:12879820..12879820
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1b
Comments: downstream of R-U106. upstream of L257
Forward Primer: YSC53_F CCCAGCACATAGTGATGACATTC
Reverse Primer: YSC53_R GAGATGACACCATTGCACTCC
Reviews

Customers who bought this product also purchased
Y18100
Y18100
A9580
A9580
FGC5797
FGC5797
S8402
S8402
ZP87
ZP87
BY114278
BY114278
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies