Top » Catalog » SNPs » Z18

$18.00

Z18
[Z18]

Z18
hg38 Position: ChrY:12879820..12879820
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1b
Comments: downstream of R-U106. upstream of L257
Forward Primer: YSC53_F CCCAGCACATAGTGATGACATTC
Reverse Primer: YSC53_R GAGATGACACCATTGCACTCC
Reviews

Customers who bought this product also purchased
A9580
A9580
Y18100
Y18100
A6915
A6915
ZP156
ZP156
S7047
S7047
FGC5797
FGC5797
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies