Top » Catalog » SNPs » Z18

$18.00

Z18
[Z18]

Z18
hg38 Position: ChrY:12879820..12879820
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1b
Comments: downstream of R-U106. upstream of L257
Forward Primer: YSC53_F CCCAGCACATAGTGATGACATTC
Reverse Primer: YSC53_R GAGATGACACCATTGCACTCC
Reviews

Customers who bought this product also purchased
FGC24039
FGC24039
Z383
Z383
S268
S268
Y13229
Y13229
L145
L145
S170
S170
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies