Top » Catalog » SNPs » Z18

$18.00

Z18
[Z18]

Z18
hg38 Position: ChrY:12879820..12879820
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1b
Comments: downstream of R-U106. upstream of L257
Forward Primer: YSC53_F CCCAGCACATAGTGATGACATTC
Reverse Primer: YSC53_R GAGATGACACCATTGCACTCC
Reviews

Customers who bought this product also purchased
S511
S511
Z159
Z159
Y3264
Y3264
R1b-L48 Panel
R1b-L48 Panel
L200
L200
FGC24039
FGC24039
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies