Top » Catalog » SNPs » Z18

$18.00

Z18
[Z18]

Z18
hg38 Position: ChrY:12879820..12879820
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1b
Comments: downstream of R-U106. upstream of L257
Forward Primer: YSC53_F CCCAGCACATAGTGATGACATTC
Reverse Primer: YSC53_R GAGATGACACCATTGCACTCC
Reviews

Customers who bought this product also purchased
P38
P38
S515
S515
FGC8604
FGC8604
S511
S511
Z159
Z159
Y3264
Y3264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies