Top » Catalog » SNPs » A27948

$18.00

A27948
[A27948]

A27948
hg38 Position: ChrY:13766774..13766774
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27948_F TTTTAGTAGAGACAGAGTTTCACCCTG
Reverse Primer: A27948_R ATGTAGTCTGGTTTTGGTTAAAAGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies