Top » Catalog » SNPs » FT41927

$18.00

FT41927
[FT41927]

FT41927
hg38 Position: ChrY:13266311..13266311
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT41927_F CAATACCTCGTTTACTGGGAGTTG
Reverse Primer: FT41927_R CTGGGACACAGCTAAAGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies