Top » Catalog » SNPs » FGC511

$18.00

FGC511
[FGC511]

FGC511
hg38 Position: ChrY:19858120..19858120
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: G2a2b2a1a1b1a3
Comments: Aka Z30837
Forward Primer: FGC511_F CCCATTGAACATTTGTCAAGTG
Reverse Primer: FGC511_R AAGAGGTATTAGAAGAGGTTTGCTTC
Reviews

Customers who bought this product also purchased
FGC499
FGC499
FGC498
FGC498
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies