Top » Catalog » SNPs » FGC32994

$18.00

FGC32994
[FGC32994]

FGC32994
hg38 Position: ChrY:7361760..7361760
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream S7364
Forward Primer: FGC32994_F TTCATGGACGTTTTGTAGGC
Reverse Primer: FGC32994_R CAGAAGACACAGACCCAGAGG
Reviews

Customers who bought this product also purchased
S756
S756
S9767
S9767
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
Z17614
Z17614
DF41
DF41
S7364
S7364
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies