Top » Catalog » SNPs » FGC32994

$18.00

FGC32994
[FGC32994]

FGC32994
hg38 Position: ChrY:7361760..7361760
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream S7364
Forward Primer: FGC32994_F TTCATGGACGTTTTGTAGGC
Reverse Primer: FGC32994_R CAGAAGACACAGACCCAGAGG
Reviews

Customers who bought this product also purchased
DF49
DF49
BY3144
BY3144
Z251
Z251
BY150
BY150
S756
S756
S9767
S9767
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies