Top » Catalog » SNPs » FGC32994

$18.00

FGC32994
[FGC32994]

FGC32994
hg38 Position: ChrY:7361760..7361760
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b1a2a1a2c1k1 (not listed)
Comments: Downstream S7364
Forward Primer: FGC32994_F TTCATGGACGTTTTGTAGGC
Reverse Primer: FGC32994_R CAGAAGACACAGACCCAGAGG
Reviews

Customers who bought this product also purchased
L1335
L1335
FGC18447
FGC18447
S764
S764
FGC45280
FGC45280
L743
L743
Z39589
Z39589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies