Top » Catalog » SNPs » FT117146

$18.00

FT117146
[FT117146]

FT117146
hg38 Position: ChrY:13463476..13463476
Ancestral: C
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT117146_F TTTAATTCCCACCTATGAGTGAGAACGCC
Reverse Primer: FT117146_R GACATTCATGCCCATGCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies