Top » Catalog » SNPs » FT117197

$18.00

FT117197
[FT117197]

FT117197
hg38 Position: ChrY:13596446..13596446
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: E
Comments: .
Forward Primer: FT117197_F GAATCCTGGCTATGCAAGAATG
Reverse Primer: FT117197_R CACTCTATTGGAAAACTTAAATGCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies