Top » Catalog » SNPs » FT117336

$18.00

FT117336
[FT117336]

FT117336
hg38 Position: ChrY:13895751..13895751
Ancestral: A
Derived: T
Reference: FTDNA (2019)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT117336_F GCAGTTAACATGGCAGGAATC
Reverse Primer: FT117336_R AGGCATTCACTAGTGGTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies