Top » Catalog » SNPs » FT270390

$18.00

FT270390
[FT270390]

FT270390
hg38 Position: ChrY:16567339..16567339
Ancestral: T
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT270390_F GCTGAAAACACATTTAACAACTCTG
Reverse Primer: FT270390_R TGCATAATAAAAAGAGAATAGTTTATTAAGAAATAC
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
FGC5427
FGC5427
ZS7528
ZS7528
FGC1707
FGC1707
FGC4474
FGC4474
ZS7531
ZS7531
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies