Top » Catalog » SNPs » FT270390

$18.00

FT270390
[FT270390]

FT270390
hg38 Position: ChrY:16567339..16567339
Ancestral: T
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT270390_F GCTGAAAACACATTTAACAACTCTG
Reverse Primer: FT270390_R TGCATAATAAAAAGAGAATAGTTTATTAAGAAATAC
Reviews

Customers who bought this product also purchased
Y235793
Y235793
FGC5
FGC5
ZS7093
ZS7093
BY38119
BY38119
FGC1696
FGC1696
FGC5427
FGC5427
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies