Top » Catalog » SNPs » FT270390

$18.00

FT270390
[FT270390]

FT270390
hg38 Position: ChrY:16567339..16567339
Ancestral: T
Derived: G
Reference: FTDNA (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FT270390_F GCTGAAAACACATTTAACAACTCTG
Reverse Primer: FT270390_R TGCATAATAAAAAGAGAATAGTTTATTAAGAAATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies