Top » Catalog » SNPs » A27436

$18.00

A27436
[A27436]

A27436
hg38 Position: ChrY:7382095..7382095
Ancestral: T
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27436_F GGGACCCACCTTCAGCG
Reverse Primer: A27436_R CCTAGCTCAAGTTTTATAAATTGTAATAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies