Top » Catalog » SNPs » BY191104

$18.00

BY191104
[BY191104]

BY191104
hg38 Position: ChrY:15168777..15168777
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY191104_F CCAAACTTATTCCCTGATAAACCTG
Reverse Primer: BY191104_R CTTAATAGCTATATTACTTTTGTGCCTGTTAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies