Top » Catalog » SNPs » BY191854

$18.00

BY191854
[BY191854]

BY191854
hg38 Position: ChrY:19818109..19818109
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY191854_F AAAAAAAAGAGGGGAGGTACTAGG
Reverse Primer: BY191854_R CCAGCTTTTTGCACCCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies