Top » Catalog » SNPs » A28046

$18.00

A28046
[A28046]

A28046
hg38 Position: ChrY:19714028..19714028
Ancestral: C
Derived: A
Reference: Milenko Subotic (2020)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: A28046_F TAGCAGGTGTTGGTGAGGTG
Reverse Primer: A28046_R TGAGGAACCGACTGGTAAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies