Top » Catalog » SNPs » ZS3683

$18.00

ZS3683
[ZS3683]

ZS3683
hg38 Position: ChrY:11870385..11870385
Ancestral: A
Derived: G
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1 (not listed)
Comments: Downstream Z1853. Found in Big Y sample N116114
Forward Primer: ZS3683_F AATTCTGCTTCAATCCCATCTG
Reverse Primer: ZS3683_R TGACCAAAGGGTAGGCTGTC
Reviews

Customers who bought this product also purchased
ZS2652
ZS2652
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies