Top » Catalog » SNPs » ZS2652

$18.00

ZS2652
[ZS2652]

ZS2652
hg38 Position: ChrY:13161745..13161745
Ancestral: T
Derived: C
Reference: Victar Mas (2014)
ISOGG Haplogroup: J1
Comments: Below P58 > Z1853
Forward Primer: ZS2652_F TTTCATGAATCCTCTGTGCAAG
Reverse Primer: ZS2652_R CTTGATGCCTGTTGCCAAG
Reviews

Customers who bought this product also purchased
ZS3683
ZS3683
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies