Top » Catalog » SNPs » BY93617

$18.00

BY93617
[BY93617]

BY93617
hg38 Position: ChrY:12063999..12063999
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: Below L21 > S1051
Forward Primer: BY93617_F AACCCCGTCTGTACCAAAAAC
Reverse Primer: BY93617_R CCCTTCTCCCCTAGACTCGA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies